Biology High School
Answers
Answer 1
Class 1 has more variability because both the range and interquartile range are greater than class 2, meaning the data is more spread out.
Importance of range and interquartile range
Range gives the spread of the whole data set, while the interquartile range gives the spread of the middle half of a data set.
A high range means a high variability of the data set.A low interquartile range means clustered middle data.
Thus, we can conclude that, Class 1 has more variability because both the range and interquartile range are greater than class 2, meaning the data is more spread out.
Learn more about range here: https://brainly.com/question/2264373
#SPJ1
Related Questions
What does DNA contain?
the coded blueprint for life
the ability to translate RNA code
the chromosomes that build proteins
the factors for heredity called alleles
Answers
Answer:
B. The coded blueprint for life
Explanation:
Give it a Like if this Helps :)
PLEASE HURRY! 100 POINTS! Select all the correct statements that apply to population 2 in this graph
Answers
Answer:
a)c) pls i need the 100 points pls
Explanation:
the graph
Researchers discover another cytokine (X) that is upregulated even more than Z as a result of exercise. Cytokine X binds to receptors in skeletal muscle to stimulate angiogenesis. After strenuous exercise, local [X] would be LEAST similar to post-exercise [Z] in:
Answers
Angiogenesis is the new blood vessels formation. After strenuous exercise, local [X] would be least similar to post-exercise [Z] in subjects in group A.
What is the impact of exercise?
After any exercise, a person's body repairs or replaces muscle fibers damaged during the exercise by fusing muscle fibers together to form new muscle protein strands called myofibrils.
These replaced myofibrils increase in thickness and number to form muscle hypertrophy. These larger muscles require more blood vessels.
If cytokine X acts to promote angiogenesis in the new muscle tissue, it will mean a person would expect large increases in the local concentration of X.
Thus the group that is least similar to this large increase in local [X] would be the group with the less increase in [Z] which is group A.
Thus, the correct option is for subjects in group A.
For more details regarding angiogenesis, visit:
https://brainly.com/question/15025488
#SPJ1
Describe the structure and function of the circulatory system. How does the circulatory system help maintain homeostasis in the human body?
Answers
Answer: The structure of the circulatory system helps with homeostasis, as it helps to transport oxygen and nutrient - rich blood throughout the whole body
Explanation:
The circulatory system is just basically a transport system transporting oxygenic, nutrient rich blood, or you can think of it as an extension system for the respitory system, after all, the whole body interacts to keep you strond and healthy.
Better hygiene, education, and wealth correlated with?
Answers
Answer:
Better hygiene, education, and wealth are correlated with their level of education.
Explanation:
Hope this helps
The technique used when the father's sperm and the mother's egg are fertilized in a laboratory dish and then placed in the mother's uterus is called __________.
Answers
Answer:
IVF
Explanation:
in vitro fertilization
which state was the pioneer to start fighting air pollution?
Answers
Answer:
California
Explanation:
The first recognized "smog" fightning occured back in Los Angeles in summer of 1943
Explain how the carbon cycle is important to the balance of nature.
Answers
Nature maintains carbon balance, which means that the amount of carbon naturally released from reservoirs equals the amount naturally absorbed by reservoirs.
Maintaining this carbon balance ensures that the earth remains habitable
Answer:
The carbon cycle is important because when you inhale, you're inhaling oxygen, when you're exhaling you're letting out carbon dioxide. Now the trees help this because the trees and plants produce oxygen, so that's what we breathe in, and carbon dioxide is what the trees and plants breathe in. So it all works out well.
Without the plants producing oxygen and us producing carbon dioxide, the whole air and atmosphere would be messed up, that is why it is so important that the carbon cycle is in balance because if it wasn't we would die and the plants would die.
Short-spined sea urchin fossils were found directly above long-spined sea urchin fossils in a layer of rock. What do the differences between the two sets of sea urchin fossils suggest about them?
Answers
The animals die, they get covered in layers. The lowest being the oldest. The difference is showing us a direct link between the two fossils. This means that the longer-spined sea urchins existed before the shorter-spined sea urchins. And evolved to have shorter spines rather than long ones.
What do you understand by the term Homology?
Homology is the term that used to describe the similarities in between biological structures or the organs in 2 or more distinct organism that comes from a common ancestors.
Thus, longer-spined sea urchins existed before the shorter-spined sea urchins.
To learn more about Homology click here:
https://brainly.com/question/13242901
#SPJ1
What is the correct numerical sequence for unlocking "DNA Structure?"
Answers
Answer:
3'TGACGACTACAACTTAATCT
Explanation:
Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.
Evolutionary change in observable time scales.
Answers
What’s the question here? Are you referring to the Geologic Record?
QUESTION 1:
True or false:
Coal is not a mineral because it is made from fossilized plants.
-------------
Question 2:
Color alone cannot be used to identify a mineral because…
A: Only a few minerals always have their own unique color
B: Luster usually hides a mineral’s true color
C: The color of most minerals is hidden by its crystals
D: Color and streak are never the same color
ANSWER FOR BRAINLIEST AND MANY POINTS
Answers
i already answered this. question 1 is false and question 2 is A
What is an important function of the seminal vesicle?.
Answers
Answer:
It produces a clear smooth liquid that combines with sperm to create semen
Explanation:
Answer: The seminal vesicle is part of the reproductive system. The vesicles have both glandular tissue and muscular tissue. The muscular tissue contracts to move seminal fluid and sperm into the urethra and out through.
How is the Excretory System organized?
Answers
Answer:
Organs of excretion make up the excretory system. They include the kidneys, large intestines, skin, liver and lungs.
The graph pictured shows bacterial growth, in a petri dish, in which no additional resources are added over time.
Which of the following is a logical conclusion about the bacterial growth in the petri dish?
A
Phase C is the result of abundant available resources.
B
Phase B is rapid growth because of limited resources.
C
Phase A is slow growth because of abundant resources.
D
Phase D is the result of limited availability of resources.
Answers
The graph pictured shows bacterial growth, in a petri dish, in which no additional resources are added over time, The graph pictured shows bacterial growth, in a petri dish, in which no additional resources are added over time.
How does the bacteria actually grow in the petri dish?
Sterile powdered agar with nutrients can be mixed with moisture, heated and then rushed into empty petri plates or ready-to-use dishes can be purchased.
The undigestible agar is a gelatin-like substance with a semi solid surface on which the bacteria can grow while they engulf the added nutrients
Thus, option "D" is correct.
To learn more about bacterial growth click here:
https://brainly.com/question/14461247
#SPJ2
During a trip, a lightly-pigmented individual is looking forward to lying on a beach and
working on his/her tan. Will evolution take place by developing a tan? Explain.
Answers
Answer:
No
Explanation:
Evolution is a process by which a species accumulates and adopts genetic changes in order to permanently change their genetic codes. Gaining a tan is the process of your skin cells being fried by UV light. Therefore, tanning is not an evolutionary act.
Which of the following statements best describes the role of hormones in the body? hormones send chemical signals throughout the body to regulate body processes. hormones are chemical signals that are sent throughout the body to regulate body processes. hormones send electrical signals throughout the body to regulate body processes. hormones are electrical signals that are sent throughout the body to regulate body processes.
Answers
Answer:
b
Explanation:
The statement that best describes the role of hormones in the body is: "Hormones are chemical signals that are sent throughout the body to regulate body processes."
How Hormones are produced ?
Hormones are produced by endocrine glands and travel through the bloodstream to target cells, where they bind to specific receptors and trigger a response in the body.
They play a crucial role in regulating a wide range of bodily functions, including growth and development, metabolism, reproduction, and response to stress.
Hormones are chemical messengers that are produced and released by various glands in the body, including the pituitary gland, thyroid gland, adrenal gland, and others.
These hormones are transported through the bloodstream to target cells or organs, where they bind to specific receptors and trigger a physiological response or regulate various body processes such as growth, metabolism, reproduction, and stress response.
The chemical signals that hormones transmit are in the form of chemical molecules, not electrical signals, and they are involved in a wide range of bodily functions.
Learn more about Hormones at:
https://brainly.com/question/30527782
#SPJ7
which event leads to a diploid cell in a life cycle?
Answers
Answer:
Fertilization
Explanation:
This image summarizes how computers sort and order DNA fragments to produce a final sequence of the genome. Explain how the sequences of many smaller fragments of DNA can be combined into a complete DNA sequence.
Answers
Single reads are where one end or the whole of a fragment of DNA is sequenced. These sequences can then be joined together by finding overlapping regions in the sequence to create the full DNA sequence.
Paired-end reads are where both ends of a fragment of DNA are sequenced.
What is the role of computer in DNA sequencing?
Computers are faster
DNA sequence codes for the amino acids that form proteins, and the code had been worked out earlier.
At first, DNA sequence was read from a gel and then summarised to amino acids.
Thus, Single reads are where one end or the whole of a fragment of DNA is sequenced.
To learn more about DNA sequencing click here:
https://brainly.com/question/23310851
#SPJ1
What type of tissue is this?
What characteristics helped you decide the type of tissue? (Identify form/structure.)
What is this tissue's function?
Answers
It is a part of a Muscular Tissue .
Location - Attached to bones , forms the wallof internal organs and in the heart.Structure -contractile tissue made up of different types of muscle fibres.Function -To give shape to the body and help in movement.
Explanation:
This is a cardiac muscle tissue.
Location: It is located in heart muscles. Structure : cylindrical having one or two nuclei in each cell.Function :It helps in beating of heart .
A cell with 22 chromosomes undergoes meiosis. How many nuclei result from this process? Need ASAP
Answers
Answer:
The overall process of meiosis produces four daughter cells from one single parent cell
Explanation:
Germ cells contain a complete set of 46 chromosomes (23 maternal chromosomes and 23 paternal chromosomes). By the end of meiosis, the resulting reproductive cells, or gametes, each have 23 genetically unique chromosomes.
YO WHO WANTS 20 POINTS TELL ME WHAT"S YOUR ANSWER DO YALL THINK DINOSAURS ARE BIRDS OR REPTILES
Answers
Answer:
both
Explanation:?
Some species of millipedes will roll into a ball when threatened, while other species of millipedes can secrete noxious chemicals from their bodies
Answers
When threatened North American Millipedes roll into a ball to protect their undersides that are the most vulnerable part of their bodies. Unlike millipedes are relatively slow creatures who like to travel at their own pace.
What is predation?
Predation is defined as a biological interaction where one organism, the predator, kills and eats another organism, its prey.
Millipedes release a harmful substance (toxin) all over their body if they are threatened or if you handle them roughly. The toxin which millipedes release keeps away most predators. Some large millipede species can spray these toxins as far as 33 inches (81 cm).
For more information regarding millipedes, visit:
https://brainly.com/question/23966335
#SPJ4
does only the nucleus of a cell is protoplasm is that true or false
Answers
Answer:
False
Explanation:
Answer:
False.
Explanation:
protoplasm include cytoplasm and other organelles too.
the nucleus is one of the constituent of the protoplasm.
Good luck ✅.
Atmospheric nitrogen has to be combined with other elements
Answers
Nitrogen in gaseous amount is 78% which is present in atmosphere. It has to be combined with other elements, or fixed, in order to be used by plants. Lightning is one way fixation of atmospheric nitrogen because when lightning occurs, the extreme heat melts the nitrogen molecules bond, allowing nitrogen to combine with oxygen and form nitrogen oxides.
What is atmosphere?
An atmosphere is referred to a layers of gases which envelope a planet, and is held in place by the gravity of the planetary body.
By a series of microbial transformations nitrogen is made available to plants, which in turn ultimately sustain all animal life.
For more information regarding, atmospheric nitrogen, visit:
https://brainly.com/question/3374024
#SPJ4
A scientist is using a telescope and sees a comet that has a tail. What can they surmise about the comet?
A. It came from the Oort Cloud.
B. It came from the Kuiper Belt.
C. It has a retrograde orbit.
D. It is close and approaching the Sun.
Answers
Answer:
It would be a mixture of A and B but if you chose one of them it would at least give credits for it
Explanation:
Answer:
D. It is close and approaching the Sun.
Explanation:
Comet's "Tails" are plasma, they are only visible when in orbit close to the Sun, because the Sun illuminates them.
An organism’s characteristics, or traits, are due to genes. Different versions of genes create different traits. What are these different versions of genes called?.
Answers
Answer:
Genotype
Explanation:
A genotype is the name for different versions of genes.
Phenotype however is what you can observe from the genotype. (brown hair, blue eyes, etc.)
9
A scientist has just discovered a new life form. This new organism is
multicellular, does not undergo photosynthesis, and absorbs nutrients from the
environment. It is composed of eukaryotic cells that have cell walls, in which
Kingdom would the organism be classified?
Animal
Bacteria
o Fungus
D Plant
Answers
fungus!
animals eat things to get their nutrients as opposed to absorption. fungi do not photosynthesize.
What is the U.S. Ocean Dumping Ban Act of 1988?
Answers
Answer:
Ocean Dumping Ban Act of 1988 - Title I: Ocean Dumping of Sewage Sludge and Industrial Waste - Amends the Marine Protection, Research, and Sanctuaries Act of 1972 to prohibit all dumping of sewage sludge and industrial waste into the ocean after 1991.
Explanation:
...
What type of nuclear decay is represented in this illustration?
HINT: Pay Attention To The End Product Here!
Beta Decay One less neutrons and one more proton
Gamma Radiation No gain or lose of particles
Alpha Particle 2 protons and 2 neutrons lost
Answers
The type nuclear decay is represented in this illustration is Alpha Particle 2 protons and 2 neutrons lost.
What is radioactive decay?
Radioactive decay us the process whereby an unstable atomic nuclear disintegrate into smaller atoms thereby lossing energy.
Therefore,
The type nuclear decay is represented in this illustration is Alpha Particle 2 protons and 2 neutrons lost.
Learn more about radioactive decay below.
https://brainly.com/question/16677661
#SPJ1